All Weeks Applied AI with DeepLearning Coursera Quiz Answers Applied AI with Deep Learning Week 01 Quiz Answers Quiz : DeepLearning Fundamentals Q1. What is an example of a vector-vector multiplication? Q2. Which equation is correct give the following vectors?…
All Weeks Improve Your Python Code Using Amazon CodeGuru Quiz Answers Improve Your Python Code Using Amazon CodeGuru Week 01 Quiz Answers Week 1: Improve Your Python Code Using Amazon CodeGuru Q1. What is a benefit of using Amazon CodeGuru…
All Weeks Amazon DynamoDB: Building NoSQL Database-Driven Applications Quiz Answers Amazon DynamoDB: Building NoSQL Database-Driven Applications Week 02 Quiz Answers Week 2: Amazon DynamoDB: Building NoSQL Database-Driven Applications Q1. Which type of database should be used to query normalized highly…
All Weeks Building Modern Python Applications on AWS Coursera Quiz Answers Building Modern Python Applications on AWS Week 01 Quiz Answers Week 1: Building Modern Python Applications on AWS Q1. When you access AWS programmatically, you use an access key…
All Weeks Algorithms on Strings Coursera Quiz Answers Algorithms on Strings Week 01 Quiz Answers Tries and Suffix Trees Quiz Answers Q1. What is the tightest estimate you can prove on the memory consumption of a trie built off nn…
All Weeks Drug Development Coursera Quiz Answers Drug Development Week 01 Quiz Answers Regulatory Considerations When Filing an Investigational New Drug Application Quiz Answers Q1. An Investigational New Drug (IND) is not required for which of the following? Q2. When…
All Weeks Drug Discovery Coursera Quiz Answers Drug Discovery Week 01 Quiz Answers Pharma and Biotech Quiz Answers Q1. According to the videos, in what direction is the pharmaceutical and biotechnology industry headed? Q2. In terms of pharmaceutical developments, why…
All Weeks Genome Sequencing (Bioinformatics II) Coursera Quiz Answers Genome Sequencing (Bioinformatics II) Week 01 Quiz Answers Q1. True or False: The human genome is not the longest genome of any organism on Earth. Q2. What is a cycle that…
All Weeks Finding Hidden Messages in DNA (Bioinformatics I) Finding Hidden Messages in DNA (Bioinformatics I) Week 01 Quiz Answers Q1. True or False: The Finding oriC Problem is a well-defined computational problem. Q2. Compute Count(ACTGTACGATGATGTGTGTCAAAG, TGT). Q3. What is…
All Weeks Fundamentals of Scalable Data Science Coursera Quiz Answers Fundamentals of Scalable Data Science Week 01 Quiz Answers Quiz : Challenges, terminology, methods and technology Q1. Which programming languages are supported for writing programs on top of ApacheSpark? Fundamentals…
