All Weeks Genome Sequencing (Bioinformatics II) Coursera Quiz Answers Genome Sequencing (Bioinformatics II) Week 01 Quiz Answers Q1. True or False: The human genome is not the longest genome of any organism on Earth. Q2. What is a cycle that…
All Weeks Finding Hidden Messages in DNA (Bioinformatics I) Finding Hidden Messages in DNA (Bioinformatics I) Week 01 Quiz Answers Q1. True or False: The Finding oriC Problem is a well-defined computational problem. Q2. Compute Count(ACTGTACGATGATGTGTGTCAAAG, TGT). Q3. What is…
All Weeks Fundamentals of Scalable Data Science Coursera Quiz Answers Fundamentals of Scalable Data Science Week 01 Quiz Answers Quiz : Challenges, terminology, methods and technology Q1. Which programming languages are supported for writing programs on top of ApacheSpark? Fundamentals…
All Weeks Customer-Centric IT Strategy Coursera Quiz Answers Customer-Centric IT Strategy Week 1 Quiz Answers Quiz 1: Week 1 Quiz on Customer-Centric Strategy Q1. Why is it important to balance designing and building in enterprise IT? Why is it hard?…
All Weeks Understanding and Visualizing Data with Python Coursera Quiz Answers Understanding and Visualizing Data with Python Coursera Quiz Answers Week 1: Understanding and Visualizing Data with Python Quiz 1: Variable Types Q1. The following five questions are focused around…
All Weeks Advanced Algorithms and Complexity Coursera Quiz Answers Advanced Algorithms and Complexity Coursera Quiz Answers Week 1: Flow Algorithms Q1. Which vertices are in the minimum S-T cut in the network below? Q2. What is the augmenting path that…
All Weeks Algorithms on Graphs Coursera Quiz Answers Algorithms on Graphs Coursera Quiz Answers Week 6: Bidirectional Dijkstra, A* and Contraction Hierarchies Q1. The Bidirectional Dijkstra algorithm from the lectures stops processing nodes as soon as it finds some node…
All Weeks Data Structures Coursera Quiz Answers Data Structures Coursera Quiz Answers Week 1: Basic Data Structures Q1. Which of the basic data structures is the most suitable if you need to access its elements by their positions in O(1)O(1)…
All Weeks Algorithmic Toolbox Coursera Quiz Answers Algorithmic Toolbox Coursera Quiz Answers Week 1: Solving Programming Challenges Q1. What will you typically need to implement yourself in the programming assignments if you program in C++, Java or Python? Q2. Your…
All Weeks Advanced Machine Learning and Signal Processing Quiz Answers Advanced Machine Learning and Signal Processing Week 01 Quiz Answers Quiz : Machine Learning Q1. Please order the following terms on their dimensionality Q2. A line can seperate two point…