Command Line Tools for Genomic Data Science Quiz Answers

Get All Weeks Command Line Tools for Genomic Data Science Quiz Answers

Command Line Tools for Genomic Data Science Week 01 Quiz Answers

Quiz 1: Module 1 Quiz

Q1. Which of the following Unix commands can be used to view the content of a file?

[expand title=View Answer] less [/expand]

Q2. Which of the following commands can be used to compress the content of a file?

[expand title=View Answer] gzip[/expand]

Q3. The file “months” lists each of the 12 months on a separate line and no further lines. What would be the result if the following command was run:

cat months | head -1000 | wc –l

[expand title=View Answer] 12[/expand]

Q4. What is the effect of using the pipe operator ‘|’ in a sequence of commands:

[expand title=View Answer] Act as a character separator between different shell commands, without any effects on the outcome [/expand]

Q5. If typing ‘pwd’ produces “/home/userA/Coursera/L1/”, which of the following commands will list the file content of the current directory?

[expand title=View Answer] ls . [/expand]

Q6. Suppose your current working directory is “/home/Coursera/L1/”, and “peach”, “apple” and “pear” are subdirectories, each containing a single file named “genome”. What would be the current directory, as reported by running the ‘pwd’ command, after each of the four commands in the sequence below:

[expand title=View Answer]
cd apple
rm *
cd ../..
mv apple pl
[/expand]

Q7. Consider the file “seasons” with the following columns separated by spaces ‘ ‘:

January 1 winter
…
December 12 winter

What would be the sequence of outputs for the following commands:
cut -d ' ' -f1,3 seasons | sort -u | wc -l" and "cut -f1 seasons | sort | uniq -c | wc -l ?

[expand title=View Answer]4, 3 [/expand]

Q8. Your current working directory is named “Plants”. Its subdirectory “apple” contains the files “apple.genome”, “apple.samples” and “apple.genes”. What would be the result of the command rmdir apple?

[expand title=View Answer] The command will have no effect, since the directory is not empty [/expand]

Q9. Suppose that you have two files, A and B, containing experiment data:

File A: File B:

geneA + geneB +
geneB + geneC +
geneC –

What would be the sequence of outputs for the commands:

(1) comm -3 A B | wc –l
(2) comm -1 -3 A B | wc –l
(3) comm -2 A B | wc –l

[expand title=View Answer] 1,2,4 [/expand]

Q10. The current working directory contains four subdirectories named “apple”, “pear”, “peach” and “strawberry”, each with the following files: “genome”, “genes” and “samples”. Which of the following commands would extract the top line from all of the “genes” files?

[expand title=View Answer] head -1 */genes [/expand]

Quiz 2: Module 1 Exam

Q1. How many chromosomes are there in the genome?

[expand title=View Answer] 3 [/expand]

Q2. How many genes?

[expand title=View Answer]5453 [/expand]

Q3. How many transcript variants?

[expand title=View Answer] 5456[/expand]

Q4. How many genes have a single splice variant?

[expand title=View Answer] 5450 [/expand]

Q5. How may genes have 2 or more splice variants?

[expand title=View Answer] 3 [/expand]

Q6. How many genes are there on the ‘+’ strand?

[expand title=View Answer] 2662 [/expand]

Q7. How many genes are there on the ‘-’ strand?

[expand title=View Answer]2791[/expand]

Q8. How many genes are there on chromosome chr1?

[expand title=View Answer]1624[/expand]

Q9. How many genes are there on each chromosome chr2?

[expand title=View Answer] 2058 [/expand]

Q10. How many genes are there on each chromosome chr3?

[expand title=View Answer] 1771 [/expand]

Q11. How many transcripts are there on chr1?

[expand title=View Answer] 1625 [/expand]

Q12. How many transcripts are there on chr2?

[expand title=View Answer] 2059 [/expand]

Q13. How many transcripts are there on chr3?

[expand title=View Answer] 1772 [/expand]

Q14. How many genes are in common between condition A and condition B?

[expand title=View Answer] 2410 [/expand]

Q15. How many genes are specific to condition A?

[expand title=View Answer] 1205 [/expand]

Q16. How many genes are specific to condition B?

[expand title=View Answer] 1243 [/expand]

Q17. How many genes are in common to all three conditions?

[expand title=View Answer] 1608 [/expand]

Command Line Tools for Genomic Data Science Week 02 Quiz Answers

Quiz 1: Module 2 Quiz

Q1. Which of the following strings cannot denote a DNA sequence:

[expand title=View Answer] MASLLRG [/expand]

Q2. How many lines does it take to specify:

i) one fasta sequence? and ii) one fastq sequence?

Select the best answer.

[expand title=View Answer] Fasta – a fasta header followed by any number of sequence lines; fastq – 4 lines [/expand]

Q3. Which of the following is incorrect:

[expand title=View Answer] BEDtools can be used to align sequences to the genome.[/expand]

Q4. Which of the following is NOT an alignment operation:

[expand title=View Answer] Cut and paste [/expand]

Q5. What is the minimum number of columns that are sufficient to specify a BED format?

[expand title=View Answer] 3[/expand]

Q6. Which of the following represents the most accurate conversion into BED of the GTF record:

chr1 CLASS exon 516 811 100 + . gene_id “genA”; transcript_id “genA.1”;
chr1 CLASS exon 1001 1115 100 + . gene_id “genA”; transcript_id “genA.1”;
chr1 CLASS exon 3010 3312 100 + . gene_id “genA”; transcript_id “genA.1”
```

[expand title=View Answer]chr1 515 3312 genA.1 100 + 515 3312 0 3 296,115,303 0,485,2494[/expand]

chr1 516 3312 genA + 516 3312 0 2 296,303 0,2494

Q7. Determine the number of genes, transcripts, exons per transcript, gene orientation (strand), and the length of 5’ most exon(s) from the GTF snippet below. Select the correct answer.

chr1 HAVANA gene 3205901 3671498 . - . gene_id "MUSG51951.5";
chr1 HAVANA transcript 3205901 3216344 . - . gene_id "MUSG51951.5"; transcript_id "MUST162897.1";
chr1 HAVANA exon 3213609 3216344 . - . gene_id "MUSG51951.5"; transcript_id "MUST162897.1”;
chr1 HAVANA exon 3205901 3207317 . - . gene_id "MUSG51951.5"; transcript_id "MUST162897.1
chr1 HAVANA transcript 3206523 3215632 . - . gene_id "MUSG51951.5"; transcript_id "MUST159265.1”;
chr1 HAVANA exon 3213439 3215632 . - . gene_id "MUSG51

[expand title=View Answer] Genes: 1; Transcripts: 2; Exons: 2,2; Strand: -; Length of 5’ exon(s): 2735, 2193.[/expand]

Q8. Which of the following is FALSE for the following read alignments:

R1 83 chr12 9232390 255 50M = 9232180 0
ATGGCAGAGCCTAATATGTCTCCTAGAGAATGGGAGAGATGGGAAGTCAT HGHHHHHHHHHHHHHHHHHHHHHHHHHHIGIIIIHHHHHHHHHHHGHHFH NM:i:0 NH:i:1 HI:i:0
R2 97 chr12 9232391 255 28M278N22M = 9242529
0 TGGCAGAGCCTAATATGTCTCCCAAAACTGAGACAGAAGCTCGGGCAGAT D>DDDHHHHHHHHHHIHIHHHHHIHHHHIGFFGGGHHHHHHHHHHFB.F NM:i:4 NH:i:3 HI:i:0 XS:A:+ NS:i:2
R3 77 * 0 0 0 * * 0 0 CTGATATGAGGAAAGAGGATTGCTTAAGCCCAGGAGGTAGAGGCTGTACC @@@FFDFFHFFHHJJJJIJEGFGIGHHIHIIIIGCDE?D?FGGCBHDGGG

[expand title=View Answer]R2 has an exact match to the genome.[/expand]

Q9. For the alignment below, which statements are FALSE? The binary encoding for 97 is 972 = 0000 0110 00012. Select all answers that apply.

R2 97 chr12 9232391 255 28M278N22M = 9242529
0 TGGCAGAGCCTAATATGTCTCCCAAAACTGAGACAGAAGCTCGGGCAGAT D>DDDHHHHHHHHHHIHIHHHHHIHHHHIGFFGGGHHHHHHHHHHFB.F NM:i:4 XS:A:+ NS:i:2

[expand title=View Answer]
The alignment passes quality checks.
The sequence of the read’s mate is reverse-complemented in its alignment.
[/expand]

Q10. Files ‘A.bed’ and ‘B.bed’ contain the following sets of intervals:

[expand title=View Answer]
bedtools intersect –wao –a A.bed –b B.bed | sort –u | wc -l
bedtools intersect –wo –a A.bed –b B.bed | cut –f1-3 | sort –u | wc -l
[/expand]

Quiz 2: Module 2 Exam

Q1. How many alignments does the set contain?

[expand title=View Answer] 221372 [/expand]

Q2. How many alignments show the read’s mate unmapped?

[expand title=View Answer] 65521 [/expand]

Q3. How many alignments contain a deletion (D)?

[expand title=View Answer] 2451[/expand]

Q4. How many alignments show the read’s mate mapped to the same chromosome?

[expand title=View Answer] 150913 [/expand]

Q5. How many alignments are spliced?

[expand title=View Answer] 0 [/expand]

Q6. How many alignments does the set contain?

[expand title=View Answer] 7081 [/expand]

Q7. How many alignments show the read’s mate unmapped?

[expand title=View Answer] 1983 [/expand]

Q8. How many alignments contain a deletion (D)?

[expand title=View Answer] 31 [/expand]

Q9. How many alignments show the read’s mate mapped to the same chromosome?

[expand title=View Answer] 4670 [/expand]

Q10. How many alignments are spliced?

[expand title=View Answer] 0 [/expand]

Q11. How many sequences are in the genome file?

[expand title=View Answer] 7 [/expand]

Q12. What is the length of the first sequence in the genome file?

[expand title=View Answer] 29923332 [/expand]

Q13. What alignment tool was used?

[expand title=View Answer] stampy [/expand]

Q14. What is the read identifier (name) for the first alignment?

[expand title=View Answer] GAII05_0002:1:113:7822:3886#0 [/expand]

Q15. What is the start position of this read’s mate on the genome? Give this as ‘chrom:pos’ if the read was mapped, or ‘*” if unmapped.

[expand title=View Answer] Chr3:11700332 [/expand]

Q16. How many overlaps (each overlap is reported on one line) are reported?

[expand title=View Answer] 3101 [/expand]

Q17. How many of these are 10 bases or longer?

[expand title=View Answer] 2899 [/expand]

Q18. How many alignments overlap the annotations?

[expand title=View Answer] 3101 [/expand]

Q19. Conversely, how many exons have reads mapped to them?

[expand title=View Answer] 21[/expand]

Q20. If you were to convert the transcript annotations in the file “athal_wu_0_A_annot.gtf” into BED format, how many BED records would be generated?

[expand title=View Answer] 4 [/expand]

Command Line Tools for Genomic Data Science Week 03 Quiz Answers

Quiz 1: Module 3 Quiz

Q1. Which of the following statements is FALSE:

[expand title=View Answer] SNP refers to a Single Non-defined Polymorphism[/expand]

Q2. Which of the following statements is FALSE:

[expand title=View Answer] The VCF format shows the changes in amino acid resulting from the nucleotide mutation, in column 3. [/expand]

Q3. What program can be used to generate a list of candidate sites of variation in an exome data set:

[expand title=View Answer] samtools [/expand]

Q4. In a comprehensive effort to study genome variation in a patient cohort, you sequence and call variants in the exome, whole genome shotgun and RNA-seq data from each patient. Which of the following is FALSE when comparing these three types of resources:

[expand title=View Answer]Exome sequencing comprehensively captures variants in the 3’ and 5’ UTRs of genes. [/expand]

Q5. Which of the following options can be used to allow bowtie2 to generate partial alignments?

[expand title=View Answer] –local [/expand]

Q6. Select the correct interpretation for the snippet of ‘mpileup’ output below.

Chr3 11700316 C 8 .$……. 8C@C;CB3
Chr3 11951491 G 16 AAAA,……aA..A C2@2BCBCCCAC2CC4

Both sites show potential variation;

[expand title=View Answer]
the alternate letter for site 1 is $, and for site 2 is A;

site 1 has 8 supporting reads, and site 2 has 16
[/expand]

Q7. Given the set of variants described in the VCF excerpt below, which of the following is FALSE?

INFO=

INFO=

FORMAT=

FORMAT=

Chr3 11966312 . G A 15.9 . DP=5;MQ=15 GT:PL 1/1:43,9,0
Chr3 11972108 . TAAAA TAAA 32.8 . INDEL;IDV=7;IMF=0.636364;DP=11;MQ=22 GT:PL 0/1:66,0,2
Chr3 13792328 rs145271872 G T 5.5 . DP=1;MQ=40 GT

[expand title=View Answer] The alternate allele for variant 1 is A [/expand]

Q8. What does the following code do:

bowtie2 –x species/species –U in.fastq | grep –v “^@” | cut –f3 | sort | uniq –c

Run bowtie2 with a set of single-end reads, reporting the top 5 alignments for a read;

then determine the number of reads mapped reverse complemented

Run bowtie2 with a set of single-end reads, allowing for local matches;

then determine the number of matches with unmapped mates

Run bowtie2 with a set of single-end reads, reporting the best alignment only;

then determine the number of matches on each genomic sequence

Run bowtie2 with a set of single-end reads, allowing for local matches;

then determine the number of exact matches on each genomic sequence

Q9. What does the following snippet of code do NOT do:

samtools mpileup –O –f genome.fa in.bam | cut –f7

[expand title=View Answer] Report in the intermediate mpileup output the qualities of all read bases aligned at that position[/expand]

Q10. What does the following code do NOT do:

bcftools call –v –c –O z –o out.vcf.gz in.vcf.gz

[expand title=View Answer]Report output in compressed VCF format

Quiz 2: Module 3 Exam

Q1. How many sequences were in the genome?

[expand title=View Answer] 7[/expand]

Q2. What was the name of the third sequence in the genome file? Give the name only, without the “>” sign.

[expand title=View Answer] Chr3[/expand]

Q3. What was the name of the last sequence in the genome file? Give the name only, without the “>” sign.

[expand title=View Answer] mitochondria [/expand]

Q4. How many index files did the operation create?

[expand title=View Answer]6 [/expand]

Q5. What is the 3-character extension for the index files created?

[expand title=View Answer] bt2[/expand]

Q6. How many reads were in the original fastq file?

[expand title=View Answer] 147354 [/expand]

Q7. How many matches (alignments) were reported for the original (full-match) setting? Exclude lines in the file containing unmapped reads.

[expand title=View Answer]137719[/expand]

Q8. How many matches (alignments) were reported with the local-match setting? Exclude lines in the file containing unmapped reads.

[expand title=View Answer] 141044 [/expand]

Q9. How many reads were mapped in the scenario in Question 7?

[expand title=View Answer] 137719 [/expand]

Q10. How many reads were mapped in the scenario in Question 8?

[expand title=View Answer] 141044 [/expand]

Q11. How many reads had multiple matches in the scenario in Question 7? You can find this in the bowtie2 summary; note that by default bowtie2 only reports the best match for each read.​

[expand title=View Answer] 43939[/expand]

Q12. How many reads had multiple matches in the scenario in Question 8? Use the format above. You can find this in the bowtie2 summary; note that by default bowtie2 only reports the best match for each read.​

[expand title=View Answer] 56105 [/expand]

Q13. How many alignments contained insertions and/or deletions, in the scenario in Question 7?

[expand title=View Answer] 2782 [/expand]

Q14. How many alignments contained insertions and/or deletions, in the scenario in Question 8?

[expand title=View Answer] 2614 [/expand]

QQ15. How many entries were reported for Chr3?

[expand title=View Answer]360295 [/expand]

Q16. How many entries have ‘A’ as the corresponding genome letter?

[expand title=View Answer] 1150985 [/expand]

Q17. How many entries have exactly 20 supporting reads (read depth)?

[expand title=View Answer] 1816 [/expand]

Q18. How many entries represent indels?

[expand title=View Answer] 1972 [/expand]

Q19. How many entries are reported for position 175672 on Chr1?

[expand title=View Answer] 2 [/expand]

Q20. How many variants are called on Chr3?

[expand title=View Answer]398 [/expand]

Q21. How many variants represent an A->T SNP? If useful, you can use ‘grep –P’ to allow tabular spaces in the search term.

[expand title=View Answer]392 [/expand]

Q22. How many entries are indels?

[expand title=View Answer] 320[/expand]

Q23. How many entries have precisely 20 supporting reads (read depth)?

[expand title=View Answer] 2 [/expand]

Q24. What type of variant (i.e., SNP or INDEL) is called at position 11937923 on Chr3?

[expand title=View Answer] SNP [/expand]

Command Line Tools for Genomic Data Science Week 04 Quiz Answers

Quiz 1: Module 4 Quiz

Q1. Which of the following is FALSE:

[expand title=View Answer] A human gene can express at most 12 splice variants. [/expand]

Q2. Which of the following is FALSE about the organization of a eukaryotic gene:

[expand title=View Answer]The length of an intron cannot be a multiple of 3. [/expand]

Q3. What programs could you use to align RNA-seq reads to: i) a reference genome, and ii) a transcript database?

[expand title=View Answer] bowtie, bwa

tophat, bwa

[/expand]

Q4. Which of the following is FALSE:

[expand title=View Answer]RNA-seq can be used to quantify the expression levels of proteins.[/expand]

Spliced reads can be used to determine the introns in a gene.

Q5. What programs could be used to: i) assemble transcripts from RNA-seq reads, and ii) identify potentially novel transcripts and genes?

[expand title=View Answer] cufflinks, cuff-compare [/expand]

Q6. Which of the following is FALSE about the gene annotations in the following GTF snippet:

chr1 MGF gene 3413609 3671498 . - . gene_id "MG051951";
chr1 MGF transcript 3413609 3416344 . - .gene_id "MG051951"; transcript_id "MT162897";
chr1 MGF exon 3413609 3416344 . - . gene_id "MG051951"; transcript_id "MT162897";
chr1 MGF transcript 3421702 3671498 . - . gene_id "MG051951"; transcript_id "MT070533";
chr1 MGF exon 3670552 3671498 . - . gene_id "MG051951"; transcript_id "MT070533";
chr1 MGF CDS 3670552 3671348 . - 0 gene_id "MG051951"; transcript_id "MT070533";
chr1 MGF exon 342170

[expand title=View Answer] Both exons of MT70533 contain both coding and non-coding sequences. [/expand]

Q7. What does the following code NOT do:

BWT2IDX=/home/me/genomes/hg20/hg20
ANNOT=/home/me/genomes/hg20/myannot.gtf
ANNOTIDX=/home/me/genomes/hg20/myannot/myannot
mkdir -p /home/me/SRR100000
tophat2 -o /home/me/SRR100000 -p 10 --max-multihits 10 \
-r 26 –-mate-std-dev 25 \
-a 6 \
-G $ANNOT –-transcriptome-index $ANNOTIDX \

[expand title=View Answer]Report spliced reads with at most 6 mismatches in the anchor site[/expand]

Q8. What does the following code NOT do:

TOPHATDIR=/home/florea/Tophat/
mkdir –p Test1
cd Test1
ln –s $TOPHATDIR/accepted_hits.bam .
cufflinks -L Test1 -p 8 –j 0.10 –F 0.05 accepted_hits.bam

[expand title=View Answer] Use the default reference transcript annotation to guide assembly[/expand]

Q9. Which of the following is NOT described in the following summary file produced by tophat:

Left reads:
Input : 60586968
Mapped : 58163843 (96.0% of input)
of these: 6832240 (11.7%) have multiple alignments (359075 have >10)
Right reads:
Input : 60586968
Mapped : 56969290 (94.0% of input)
of these: 6668479 (11.7%) have multiple alignments (358573 have >10)
95.0% overall read mapping rate.

[expand title=View Answer] The reads were 100 bp long[/expand]

Q10. Which of the following is NOT TRUE about the output below, obtained from a cuffdiff differential expression analysis:

XLOC_000002 XLOC_000002 AT1G01020 1:5927-8737 q1 q2 OK 1.13032 3.48406 1.62404 0.694576 0.5277 0.998846 no
XLOC_000004 XLOC_000004 AT1G01073 1:44676-44787 q1 q2 NOTEST 0 0 0 0 1 1 no
XLOC_000042 XLOC_000042 AT1G01580 1:209394-213041 q1 q2 OK 1.59512 0 -inf nan 5e-05 0.0096703 yes

[expand title=View Answer] There are too many alignments for testing for differential expression at locus XLOC_000004 [/expand]

Quiz 2: Module 4 Exam

Q1. How many alignments were produced for the ‘Day8’ RNA-seq data set?

[expand title=View Answer]63845 [/expand]

Q2. How many alignments were produced for the ‘Day16’ RNA-seq data set?

[expand title=View Answer] 58398 [/expand]

Q3. How many reads were mapped in ‘Day8’ RNA-seq data set?

[expand title=View Answer] 63489 [/expand]

Q4. How many reads were mapped in ‘Day16’ RNA-seq data set?

[expand title=View Answer] 57951 [/expand]

Q5. How many reads were uniquely aligned in ‘Day8’ RNA-seq data set?

[expand title=View Answer] 63133[/expand]

Q6. How many reads were uniquely aligned in ‘Day16’ RNA-seq data set?

[expand title=View Answer] 57504 [/expand]

Q7. How many spliced alignments were reported for ‘Day8’ RNA-seq data set?

[expand title=View Answer] 8596 [/expand]

Q8. How many spliced alignments were reported for ‘Day16’ RNA-seq data set?

[expand title=View Answer] 10695 [/expand]

Q9. How many reads were left unmapped from ‘Day8’ RNA-seq data set?

[expand title=View Answer] 84[/expand]

Q10. How many reads were left unmapped from ‘Day16’ RNA-seq data set?

[expand title=View Answer] 34 [/expand]

Q11. How many genes were generated by cufflinks for Day8?

[expand title=View Answer] 186[/expand]

Q12. How many genes were generated by cufflinks for Day16?

[expand title=View Answer] 80 [/expand]

Q13. How many transcripts were reported for Day8?

[expand title=View Answer] 192 [/expand]

Q14. How many transcripts were reported for Day16?

[expand title=View Answer] 92 [/expand]

Q15. How many single transcript genes were produced for Day8?

[expand title=View Answer] 180 [/expand]

Q16. How many single transcript genes were produced for Day16?

[expand title=View Answer] 69 [/expand]

Q17. How many single-exon transcripts were in the Day8 set?

[expand title=View Answer] 119[/expand]

Q18. How many single-exon transcripts were in the Day16 set?

[expand title=View Answer] 24 [/expand]

Q19. How many multi-exon transcripts were in the Day8 set?

[expand title=View Answer] 73 [/expand]

Q20. How many multi-exon transcripts were in the Day16 set?

[expand title=View Answer] 68 [/expand]

Q21. How many cufflinks transcripts fully reconstruct annotation transcripts in Day8?

[expand title=View Answer] 16 [/expand]

Q22. How many cufflinks transcripts fully reconstruct annotation transcripts in Day16?

[expand title=View Answer] 36 [/expand]

Q23. How many splice variants does the gene AT4G20240 have in the Day8 sample?

[expand title=View Answer] 2 [/expand]

Q24. How many splice variants does the gene AT4G20240 have in the Day16 sample?

[expand title=View Answer]0 [/expand]

Q25. How many cufflinks transcripts are partial reconstructions of reference transcripts (‘contained’)? (Day8)

[expand title=View Answer] 133 [/expand]

Q26. How many cufflinks transcripts are partial reconstructions of reference transcripts (‘contained’)? (Day16)

[expand title=View Answer] 21 [/expand]

Q27. How many cufflinks transcripts are novel splice variants of reference genes? (Day8)

[expand title=View Answer]14 [/expand]

Q28. How many cufflinks transcripts are novel splice variants of reference genes? (Day16)

[expand title=View Answer] 22 [/expand]

Q29. How many cufflinks transcripts were formed in the introns of reference genes? (Day8)

[expand title=View Answer] 4 [/expand]

Q30. How many cufflinks transcripts were formed in the introns of reference genes? (Day16)

[expand title=View Answer] 1 [/expand]

Q31. How many genes (loci) were reported in the merged.gtf file?

[expand title=View Answer] 129[/expand]

Q32. How many transcripts?

[expand title=View Answer]200 [/expand]

Q33. How many genes total were included in the gene expression report from cuffdiff?

[expand title=View Answer] 129 [/expand]

Q34. How many genes were detected as differentially expressed?

[expand title=View Answer] 4 [/expand]

Q35. How many transcripts were differentially expressed between the two samples?

[expand title=View Answer]5 [/expand]

Get All Course Quiz Answers for the Genomic Data Science Specialization

Introduction to Genomic Technologies Coursera Quiz Answers

Python for Genomic Data Science Coursera Quiz Answers

Algorithms for DNA Sequencing Coursera Quiz Answers

Command Line Tools for Genomic Data Science Coursera Quiz Answers

Bioconductor for Genomic Data Science Coursera Quiz Answers

Statistics for Genomic Data Science