Comparing Genes, Proteins, and Genomes (Bioinformatics III) Quiz Answers

Get Comparing Genes, Proteins, and Genomes (Bioinformatics III) Quiz Answers

Once we have sequenced genomes in the previous course, we would like to compare them to determine how species have evolved and what makes them different.

In the first half of the course, we will compare two short biological sequences, such as genes (i.e., short sequences of DNA) or proteins. We will encounter a powerful algorithmic tool called dynamic programming that will help us determine the number of mutations that have separated the two genes/proteins.

Enroll on Coursera

Comparing Genes, Proteins, and Genomes (Bioinformatics III) Coursera Quiz Answers

Week 1: Comparing Genes, Proteins, and Genomes (Bioinformatics III)

Q1. There is a unique longest common subsequence of the strings GCGATC and CTGACG. What is it?

Enter answer here

Q2. True or False: GreedyChange solves the Change Problem (i.e., finds a minimum number of coins making change) for every choice of coin denominations.

  • True
  • False

Q3. Imagine a hypothetical world in which there are two amino acids, X and Z, having respective masses 2 and 3. How many linear peptides can be formed from these amino acids having mass equal to 22? (Remember that the order of amino acids matters.)

Enter answer here

Q4. True or False: Not all recursive algorithms are inefficient.

  • True
  • False

Q5. Consider the following adjacency list of a DAG:

  1. a -> b: 5
  2. a -> c: 6
  3. a -> d: 5
  4. b -> c: 2
  5. b -> f: 9
  6. c -> e: 4
  7. c -> f: 3
  8. c -> g: 7
  9. d -> e: 4
  10. d -> f: 5
  11. e -> g: 2
  12. f -> g: 1

What is the longest path in this graph? Give your answer as a sequence of nodes separated by spaces. (Note: a, b, c, d, e, f, g is a topological order for this graph.)

Enter answer here

Q6. Here is the adjacency list of a graph with six nodes and ten edges:

  1. a -> b, c, d, e, f
  2. b -> c, f
  3. c -> d
  4. d ->
  5. e -> d, f
  6. f ->

Which of the following are topological orderings of the nodes in this graph? (Select all that apply.)

  • a, b, c, e, d, f
  • a, e, b, c, f, d
  • a, b, e, c, f, d
  • a, b, e, d, c, f
  • a, b, e, f, d, c
  • a, b, c, d, e, f

Q7. True or False: The dynamic programming algorithm we introduced for finding a longest path in a DAG has runtime proportional to the number of edges in the graph.

  • True
  • False

Week 2: Comparing Genes, Proteins, and Genomes (Bioinformatics III)

Q1. Consider the following alignment:

A-C–GTTAC

ATGCAG—T

What is the score of this alignment if the match score is 1, the mismatch penalty is 1, and the indel penalty is 2?

Enter answer here

Q2. Consider the following alignment:

A–ATAGCGACGCCTCGA

CCGATA-CGATA-CATAGC

What is the score of the bold portion of this alignment as a local alignment if the match score is 1, the mismatch penalty is 3, and the indel penalty is 1?

Enter answer here

Q3. Say that the match score is 1, the mismatch penalty is 1, and the indel penalty is 1.

What is the maximum score of a fitting alignment of ACGTCG and GTTGGATTACGAATCGATATCTGTTTG? (Hint: don’t make this problem too difficult.)

Enter answer here

Q4. Say that the match score is 1, the mismatch penalty is 0, and the indel penalty is 2.

Score the following overlap alignment.

1 AGTACATCAGAGGAGTT-ACATACTAACG
2 AGTTCACAGGCTA-CGTACAGATATTACGACAGGCAGA
Enter answer here

Q5. What type of alignment should you use if you are interested in aligning an entire string against a short interval from another string?

  • Global alignment
  • Local alignment
  • Fitting alignment
  • Overlap alignment

Week 3: Comparing Genes, Proteins, and Genomes (Bioinformatics III)

Q1. Consider the following alignment:

TCGAC–ATT

CC—GAA-T

What is the score of this alignment if the match score is 1, the mismatch penalty is 1, and the indel penalty is affine with a gap opening penalty of 4 and a gap extension penalty of 1?

Enter answer here

Q2. True or False: Using a three-level Manhattan is quicker than using a Manhattan with long indel edges to solve the Alignment with Affine Gap Penalties Problem.

  • True
  • False

Q3. True or False: A longest path in an alignment graph have more than one middle node.

  • True
  • False

Q4. There is a unique multiple longest common subsequence of CGGAACTGGT, TGAGACGGTA, and TGCGACGGCT. What is it?

Enter answer here

Q5. True or False: Optimal pairwise alignments of three strings always can be assembled into an optimal 3-way alignment.

  • True
  • False

Week 4: Comparing Genes, Proteins, and Genomes (Bioinformatics III)

Q1. True or False: genome rearrangements can be thought of as genomic erosion.

  • True
  • False

Q2. Compute the number of steps required by GreedySorting to sort the following permutation (i.e., to transform it into the identity permutation.)

(+2 +6 -8 -17 +7 -14 +18 +3 -5 -16 -11 -19 -4 +10 +13 -20 -1 +9 -12 +15)

Enter answer here

Q3. Compute the number of breakpoints in the following permutation.

(+10 +6 -8 -7 +17 -20 +18 +19 -5 -16 -11 -4 -3 -2 +13 +14 -1 +9 -12 +15)

Enter answer here

Q4. True or False: For some permutations, it is impossible to find a reversal that decreases the number of breakpoints.

  • True
  • False

Week 5: Comparing Genes, Proteins, and Genomes (Bioinformatics III)

Q1. Given the genome containing the circular chromosomes (+1 +2 +3 +4)(+5 +6)(+7+8+9), which of the following is a genome resulting from a 2-break on this genome? (Select all that apply.)

  • (+1 +2)(+3 +4)(+5 +6)(+7 +8 +9)
  • (+1 +2 +3 +4 +5 +6 +7 +8 +9)
  • (+1 +2 +3 +4)(+5 +6)(+7 -9 -8)
  • (+7 +8 +3 +4)(+5 +6)(+1 +2 +9)

Q2. What is the maximum number of cycles that the breakpoint graph of two genomes with 100 synteny blocks can have?

Enter answer here

Q3. Say that genomes P and Q share 200 synteny blocks. P has 27 circular chromosomes, Q has 19 circular chromosomes, and the 2-break distance between P and Q is 46. How many red-blue alternating cycles are there in the breakpoint graph of P and Q?

Enter answer here

Q4. Give the number of shared 3-mers of TCTTGCAGCTCGTCA and GTACTTTCAGAATCA. Please make sure that you consult the definition of shared k-mers from the epilogue in the interactive text.

Enter answer here

Q5. True or False: Evidence suggests that there are not rearrangement hotspots in the human genome.

  • True
  • False
Comparing Genes, Proteins, and Genomes (Bioinformatics III) Course Review:

In our experience, we suggest you enroll in Comparing Genes, Proteins, and Genomes (Bioinformatics III) courses and gain some new skills from Professionals completely free and we assure you will be worth it.

Comparing Genes, Proteins, and Genomes (Bioinformatics III) course is available on Coursera for free, if you are stuck anywhere between quiz or graded assessment quiz, just visit Networking Funda to get Comparing Genes, Proteins, and Genomes (Bioinformatics III) Quiz Answers.

Conclusion:

I hope this Comparing Genes, Proteins, and Genomes (Bioinformatics III) Quiz Answers would be useful for you to learn something new from this Course. If it helped you then don’t forget to bookmark our site for more Coursera Quiz Answers.

This course is intended for audiences of all experiences who are interested in learning about new skills in a business context; there are no prerequisite courses.

Keep Learning!

Get All Course Quiz Answers of

Finding Hidden Messages in DNA (Bioinformatics I) Quiz Answers

Genome Sequencing (Bioinformatics II) Coursera Quiz Answers

Comparing Genes, Proteins, and Genomes (Bioinformatics III) Quiz Answers

Leave a Reply

error: Content is protected !!